Spatio-Temporal Evolution and Driving Factors of "Non-Grain Production” in Hubei Province Based on a Non-Grain Index

Non-grain production (NGP) on cultivated land has become a common phenomenon due to the prosperity of the rural economy and the optimisation of the agricultural structure. However, the excessive use of cultivating land for NGP has threatened food production and the sustainable use of cultivated land. To halt this trend and to ensure food security, the authors of this paper applied a novel non-grain index to measure NGP, which could reflect multiple NGP activities;designated Hubei Province as its object of research;and revealed NGP's spatio-temporal patterns of the past 30 years. We then assessed the characteristics of NGP based on spatial autocorrelation analysis, the Theil index, and geographically weighted regression. The results showed that the value of the non-grain index grew from 0.497 to 1.113 as NGP increased significantly in Hubei Province. The number of high-NGP counties increased, spatial agglomeration became obvious, and the eastern and western sides of Hubei Province witnessed an observable growth in NGP. As a result, the NGP in the eastern and western regions overtook production in the central region. Despite a series of historical subsidy policies and agricultural modernisation initiatives that promoted the planting of grain crops, the policy of "grain on valuable cultivated land” could be better implemented. We conclude by making some suggestions for reducing NGP and protecting cultivated land.

Multi-omics blood atlas reveals unique features of immune and platelet responses to SARS-CoV-2 Omicron breakthrough infection.

Although host responses to the ancestral SARS-CoV-2 strain are well described, those to the new Omicron variants are less resolved. We profiled the clinical phenomes, transcriptomes, proteomes, metabolomes, and immune repertoires of >1,000 blood cell or plasma specimens from SARS-CoV-2 Omicron patients. Using in-depth integrated multi-omics, we dissected the host response dynamics during multiple disease phases to reveal the molecular and cellular landscapes in the blood. Specifically, we detected enhanced interferon-mediated antiviral signatures of platelets in Omicron-infected patients, and platelets preferentially formed widespread aggregates with leukocytes to modulate immune cell functions. In addition, patients who were re-tested positive for viral RNA showed marked reductions in B cell receptor clones, antibody generation, and neutralizing capacity against Omicron. Finally, we developed a machine learning model that accurately predicted the probability of re-positivity in Omicron patients. Our study may inspire a paradigm shift in studying systemic diseases and emerging public health concerns.

Mitigating the impacts of the COVID-19 pandemic on vulnerable populations: Lessons for improving health and social equity.

The COVID-19 pandemic had an inequitable and disproportionate impact on vulnerable populations, reversing decades of progress toward healthy populations and poverty alleviation. This study examines various programmatic tools and policy measures used by governments to support vulnerable populations during the pandemic. A comparative case study of 15 countries representing all World Health Organization's regions offers a comprehensive picture of countries with varying income statuses, health system arrangements and COVID-19 public health measures. Through a systematic desk review and key informant interviews, we report a spectrum of mitigation strategies deployed in these countries to address five major types of vulnerabilities (health, economic, social, institutional and communicative). We found a multitude of strategies that supported vulnerable populations such as migrant workers, sex workers, prisoners, older persons and school-going children. Prioritising vulnerable populations during the early phase of COVID-19 vaccination campaigns, direct financial subsidies and food assistance programmes were the most common measures reported. Additionally, framing public health information and implementing culturally sensitive health promotion interventions helped bridge the communication barriers in certain instances. However, these measures remain insufficient to protect vulnerable populations comprehensively. Our findings point to the need to expand fiscal space for health, enlarge healthcare coverage, incorporate equity principles in all policies, leverage technology, multi-stakeholder co-production of policies and tailored community engagement mechanisms.

Exploring the co-movements between COVID-19 pandemic and international air traffic: A global perspective based on wavelet analysis.

The travel and tourism industry was one of the fastest-growing industries before the onset of the COVID-19 pandemic. However, to avoid COVID-19 spread, the government authorities imposed strict lockdown and international border restrictions except for some emergency international flights that badly hit the travel and tourism industry. The study explores the nexus between international air departures and the COVID-19 pandemic in this strain. We use a novel wavelet coherence approach to dissect the lead and lag relationships between international flight departures and COVID-19 deaths from January 2020 to September 2020 (COVID-19 first wave period). The results reveal that international flights cause the spread of COVID-19 spread during May 2020 to June 2020 worldwide. The overall findings suggest asymmetries between daily international flight departures and COVID-19 deaths globally at different time-frequency periods due to uncertainty surrounding the COVID-19 pandemic. The study will be conducive for the policymakers to control the upsurge of COVID-19 spread worldwide.

Orthogonal dual reporter-based gain-of-signal assay for probing SARS-CoV-2 3CL protease activity in living cells: inhibitor identification and mutation investigation.

ABSTRACTThe main protease (3-chymotrypsin-like protease, 3CLpro) of SARS-CoV-2 has become a focus of anti-coronavirus research. Despite efforts, drug development targeting 3CLpro has been hampered by limitations in the currently available activity assays. Additionally, the emergence of 3CLpro mutations in circulating SARS-CoV-2 variants has raised concerns about potential resistance. Both emphasize the need for a more reliable, sensitive, and facile 3CLpro assay. Here, we report an orthogonal dual reporter-based gain-of-signal assay for measuring 3CLpro activity in living cells. It builds on the finding that 3CLpro induces cytotoxicity and reporter expression suppression, which can be rescued by its inhibitor or mutation. This assay circumvents most limitations in previously reported assays, especially false positives caused by nonspecific compounds and signal interference from test compounds. It is also convenient and robust for high throughput screening of compounds and comparing the drug susceptibilities of mutants. Using this assay, we screened 1789 compounds, including natural products and protease inhibitors, with 45 compounds that have been reported to inhibit SARS-CoV-2 3CLpro among them. Except for the approved drug PF-07321332, only five of these inhibit 3CLpro in our assays: GC376; PF-00835231; S-217622; Boceprevir; and Z-FA-FMK. The susceptibilities of seven 3CLpro mutants prevalent in circulating variants to PF-07321332, S-217622, and GC376 were also assessed. Three mutants were identified as being less susceptible to PF-07321322 (P132H) and S-217622 (G15S, T21I). This assay should greatly facilitate the development of novel 3CLpro-targeted drugs and the monitoring of the susceptibility of emerging SARS-CoV-2 variants to 3CLpro inhibitors.

[A cross-sectional study of enterovirus nucleic acid test with throat swabs for term late neonates during coronavirus disease 2019]. / æ–°åž‹å† çŠ¶ç— æ¯’æ„ŸæŸ“æœŸé—´è¶³æœˆçš„æ™šæœŸæ–°ç”Ÿå„¿å’½æ‹­å­è‚ é“ç— æ¯’æ ¸é ¸æ£€æµ‹æ¨ªæ–­é¢ç ”ç©¶.

OBJECTIVES: To investigate the positive rate of enterovirus (EV) nucleic acid in throat swabs of term late neonates hospitalized during the coronavirus disease 2019 (COVID-19) epidemic and the clinical characteristics of the neonates. METHODS: A single-center cross-sectional study was performed on 611 term late infants who were hospitalized in the neonatal center from October 2020 to September 2021. Throat swabs were collected on admission for coxsackie A16 virus/EV71/EV universal nucleic acid testing. According to the results of EV nucleic acid test, the infants were divided into a positive EV nucleic acid group (8 infants) and a negative EV nucleic acid group (603 infants). Clinical features were compared between the two groups. RESULTS: Among the 611 neonates, 8 tested positive for EV nucleic acid, with a positive rate of 13.1‰, among whom 7 were admitted from May to October. There was a significant difference in the proportion of infants contacting family members with respiratory infection symptoms before disease onset between the positive and negative EV nucleic acid groups (75.0% vs 10.9%, P<0.001). There were no significant differences between the two groups in demographic data, clinical symptoms, and laboratory test results (P>0.05). CONCLUSIONS: There is a certain proportion of term late infants testing positive for EV nucleic acid in throat swabs during the COVID-19 epidemic, but the proportion is low. The clinical manifestations and laboratory test results of these infants are non-specific. Transmission among family members might be an important cause of neonatal EV infection.

Development of an Indirect Enzyme-Linked Immunosorbent Assay Based on the Yeast-Expressed CO-26K-Equivalent Epitope-Containing Antigen for Detection of Serum Antibodies against Porcine Epidemic Diarrhea Virus.

Porcine epidemic diarrhea (PED) is a severe contagious intestinal disease caused by the porcine epidemic diarrhea virus (PEDV), which leads to high mortality in piglets. In this study, by analyzing a total of 53 full-length spike genes and COE domain regions of PEDVs, the conserved COE fragment of the spike protein from the dominant strain SC1402 was chosen as the target protein and expressed successfully in Pichia pastoris (P. pastoris). Furthermore, an indirect enzyme-linked immunosorbent assay (iELISA) based on the recombinant COE protein was developed for the detection of anti-PEDV antibodies in pig sera. The results showed that under the optimized conditions, the cut-off value of COE-based indirect ELISA (COE-iELISA) was determined to be 0.12. Taking the serum neutralization test as standard, the relative sensitivity of the COE-iELISA was 94.4% and specificity 92.6%. Meanwhile, no cross-reactivity to other porcine pathogens was noted with this assay. The intra-assay and inter-assay coefficients of variation were less than 7%. Moreover, 164 vaccinated serum samples test showed that overall agreement between COE-iELISA and the actual diagnosis result was up to 99.4%. More importantly, the developed iELISA exhibited a 95.08% agreement rate with the commercial ELISA kit (Kappa value = 0.88), which suggested that the expressed COE protein was an effective antigen in serologic tests and the established COE-iELISA is reliable for monitoring PEDV infection in pigs or vaccine effectiveness.

Glycemic Control in Critically Ill COVID-19 Patients: Systematic Review and Meta-Analysis.

Background: Given the mortality risk in COVID-19 patients, it is necessary to estimate the impact of glycemic control on mortality rates among inpatients by designing and implementing evidence-based blood glucose (BG) control methods. There is evidence to suggest that COVID-19 patients with hyperglycemia are at risk of mortality, and glycemic control may improve outcomes. However, the optimal target range of blood glucose levels in critically ill COVID-19 patients remains unclear, and further research is needed to establish the most effective glycemic control strategies in this population. Methods: The investigation was conducted according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA). Data sources were drawn from Google Scholar, ResearchGate, PubMed (MEDLINE), Cochrane Library, and Embase databases. Randomized controlled trials, non-randomized controlled trials, retrospective cohort studies, and observational studies with comparison groups specific to tight glycemic control in COVID-19 patients with and without diabetes. Results: Eleven observational studies (26,953 patients hospitalized for COVID-19) were included. The incidence of death was significantly higher among COVID-19 patients diagnosed with diabetes than those without diabetes (OR = 2.70 [2.11, 3.45] at a 95% confidence interval). Incidences of death (OR of 3.76 (3.00, 4.72) at a 95% confidence interval) and complications (OR of 0.88 [0.76, 1.02] at a 95% confidence interval) were also significantly higher for COVID-19 patients with poor glycemic control. Conclusion: These findings suggest that poor glycemic control in critically ill patients leads to an increased mortality rate, infection rate, mechanical ventilation, and prolonged hospitalization.

Establishment of angiotensin-converting enzyme 2 and cluster of differentiation 147 dual target cell membrane chromatography based on SNAP-tag technology for screening anti severe acute respiratory syndrome coronavirus 2 active components

Patients have different responses to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infections and these may be life-threatening for critically ill patients. Screening components that act on host cell receptors, especially multi-receptor components, is challenging. The in-line combination of dual-targeted cell membrane chromatography and a liquid chromatography-mass spectroscopy (LC-MS) system for analyzing angiotensin-converting enzyme 2 (ACE2) and cluster of differentiation 147 (CD147) receptors based on SNAP-tag technology provides a comprehensive solution for screening multiple components in complex samples acting on the two receptors. The selectivity and applicability of the system were validated with encouraging results. Under the optimized conditions, this method was used to screen for antiviral components in Citrus aurantium extracts. The results showed that 25 μmol /L of the active ingredient could inhibit virus entry into cells. Hesperidin, neohesperidin, nobiletin, and tangeretin were identified as antiviral components. In vitro pseudovirus assays and macromolecular cell membrane chromatography further verified the interaction of these four components with host-virus receptors, showing good effects on some or all of the pseudoviruses and host receptors. In conclusion, the in-line dual-targeted cell membrane chromatography LC-MS system developed in this study can be used for the comprehensive screening of antiviral components in complex samples. It also provides new insight into small-molecule drug-receptor and macromolecular-protein-receptor interactions.

Centrifugal microfluidic-based multiplex recombinase polymerase amplification assay for rapid detection of SARS-CoV-2.

The COVID-19 pandemic has spread worldwide, and rapid detection of the SARS-CoV-2 virus is crucial for infection surveillance and epidemic control. This study developed a centrifugal microfluidics-based multiplex reverse transcription recombinase polymerase amplification (RT-RPA) assay for endpoint fluorescence detection of the E, N, and ORF1ab genes of SARS-CoV-2. The microscope slide-shaped microfluidic chip could simultaneously accomplish three target genes and one reference human gene (i.e., ACTB) RT-RPA reactions in 30 min, and the sensitivity was 40 RNA copies/reaction for the E gene, 20 RNA copies/reaction for the N gene, and 10 RNA copies/reaction for the ORF1ab gene. The chip demonstrated high specificity, reproducibility, and repeatability. Chip performance was also evaluated using real clinical samples. Thus, this rapid, accurate, on-site, and multiplexed nucleic acid test microfluidic chip would significantly contribute to detecting patients with COVID-19 in low-resource settings and point-of-care testing (POCT) and, in the future, could be used to detect emerging new variants of SARS-CoV-2.

Recent Advances in Antiviral Activities of Triterpenoids.

Triterpenoids, important secondary plant metabolites made up of six isoprene units, are found widely in higher plants and are studied for their structural variety and wide range of bioactivities, including antiviral, antioxidant, anticancer, and anti-inflammatory properties. Numerous studies have demonstrated that different triterpenoids have the potential to behave as potential antiviral agents. The antiviral activities of triterpenoids and their derivatives are summarized in this review, with examples of oleanane, ursane, lupane, dammarane, lanostane, and cycloartane triterpenoids. We concentrated on the tetracyclic and pentacyclic triterpenoids in particular. Furthermore, the particular viral types and possible methods, such as anti-human immunodeficiency virus (HIV), anti-influenza virus, and anti-hepatitis virus, are presented in this article. This review gives an overview and a discussion of triterpenoids as potential antiviral agents.

The Risk Factors and Outcomes for Radiological Abnormalities in Early Convalescence of COVID-19 Patients Caused by the SARS-CoV-2 Omicron Variant: A Retrospective, Multicenter Follow-up Study.

BACKGROUND: The emergence of the severe acute respiratory syndrome coronavirus 2 omicron variant has been triggering the new wave of coronavirus disease 2019 (COVID-19) globally. However, the risk factors and outcomes for radiological abnormalities in the early convalescent stage (1 month after diagnosis) of omicron infected patients are still unknown. METHODS: Patients were retrospectively enrolled if they were admitted to the hospital due to COVID-19. The chest computed tomography (CT) images and clinical data obtained at baseline (at the time of the first CT image that showed abnormalities after diagnosis) and 1 month after diagnosis were longitudinally analyzed. Uni-/multi-variable logistic regression tests were performed to explore independent risk factors for radiological abnormalities at baseline and residual pulmonary abnormalities after 1 month. RESULTS: We assessed 316 COVID-19 patients, including 47% with radiological abnormalities at baseline and 23% with residual pulmonary abnormalities at 1-month follow-up. In a multivariate regression analysis, age ≥ 50 years, body mass index ≥ 23.87, days after vaccination ≥ 81 days, lymphocyte count ≤ 1.21 × 10-9/L, interleukin-6 (IL-6) ≥ 10.05 pg/mL and IgG ≤ 14.140 S/CO were independent risk factors for CT abnormalities at baseline. The age ≥ 47 years, presence of interlobular septal thickening and IL-6 ≥ 5.85 pg/mL were the independent risk factors for residual pulmonary abnormalities at 1-month follow-up. For residual abnormalities group, the patients with less consolidations and more parenchymal bands at baseline could progress on CT score after 1 month. There were no significant changes in the number of involved lung lobes and total CT score during the early convalescent stage. CONCLUSION: The higher IL-6 level was a common independent risk factor for CT abnormalities at baseline and residual pulmonary abnormalities at 1-month follow-up. There were no obvious radiographic changes during the early convalescent stage in patients with residual pulmonary abnormalities.

Establishment of angiotensin-converting enzyme 2 and cluster of differentiation 147 dual target cell membrane chromatography based on SNAP-tag technology for screening anti severe acute respiratory syndrome coronavirus 2 active components.

Patients have different responses to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infections and these may be life-threatening for critically ill patients. Screening components that act on host cell receptors, especially multi-receptor components, is challenging. The in-line combination of dual-targeted cell membrane chromatography and a liquid chromatography-mass spectroscopy (LC-MS) system for analyzing angiotensin-converting enzyme 2 (ACE2) and cluster of differentiation 147 (CD147) receptors based on SNAP-tag technology provides a comprehensive solution for screening multiple components in complex samples acting on the two receptors. The selectivity and applicability of the system were validated with encouraging results. Under the optimized conditions, this method was used to screen for antiviral components in Citrus aurantium extracts. The results showed that 25 µmol /L of the active ingredient could inhibit virus entry into cells. Hesperidin, neohesperidin, nobiletin, and tangeretin were identified as antiviral components. In vitro pseudovirus assays and macromolecular cell membrane chromatography further verified the interaction of these four components with host-virus receptors, showing good effects on some or all of the pseudoviruses and host receptors. In conclusion, the in-line dual-targeted cell membrane chromatography LC-MS system developed in this study can be used for the comprehensive screening of antiviral components in complex samples. It also provides new insight into small-molecule drug-receptor and macromolecular-protein-receptor interactions.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

The E3 ligase RNF5 restricts SARS-CoV-2 replication by targeting its envelope protein for degradation.

The coronavirus disease 2019 (COVID-19) pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has caused a severe global health crisis; its structural protein envelope (E) is critical for viral entry, budding, production, and induction of pathology which makes it a potential target for therapeutics against COVID-19. Here, we find that the E3 ligase RNF5 interacts with and catalyzes ubiquitination of E on the 63rd lysine, leading to its degradation by the ubiquitin-proteasome system (UPS). Importantly, RNF5-induced degradation of E inhibits SARS-CoV-2 replication and the RNF5 pharmacological activator Analog-1 alleviates disease development in a mouse infection model. We also found that RNF5 is distinctively expressed in different age groups and in patients displaying different disease severity, which may be exploited as a prognostic marker for COVID-19. Furthermore, RNF5 recognized the E protein from various SARS-CoV-2 strains and SARS-CoV, suggesting that targeting RNF5 is a broad-spectrum antiviral strategy. Our findings provide novel insights into the role of UPS in antagonizing SARS-CoV-2 replication, which opens new avenues for therapeutic intervention to combat the COVID-19 pandemic.

Management for stroke intelligent early warning empowered by big data.

Global aging population, especially with the global pandemic outbreak of the Corona Virus Disease 2019 (COVID-19), has endangered human health security. Digital information technology through big data empowerment and intelligent application is widely considered a key element to solve the problems. Stroke is a life-threaten disorder. We studied individual health management and disease risk perception using human health assessment model and make full use of wearable wireless sensor, Internet of Things, big data, and Artificial Intelligence for potential risk monitoring and real-time stroke warning. We proposed an effective method of monitoring, early warning and rescue to improve the stroke treatment. The result shows that the health management empowered by big data can generate new opportunities and ideas to solve early detection and warning of stroke.

Trace detection of SARS-CoV-2 N-protein by diamond solution-gate field-effect transistor.

In this study, we introduced H-terminated diamond solution-gate field-effect transistor (H-diamond SGFET) to detect trace SARS-CoV-2 N-protein, which plays an important role in replication and transcription of viral RNA. 1-Pyrenebutyric acid-N-hydroxy succinimide ester (Pyr-NHS) was modified on H-diamond surface as linker, on which the specific antibody of SARS-CoV-2 N-protein was catenated. Fourier transform infrared spectrum, scanning electron microscope and energy dispersive spectrum were utilized to demonstrate the modification of H-diamond with Pyr-NHS and antibody. Shifts of IDS(max) at VGS = -500 mV in transfer characteristics of H-diamond SGFET was observed to determine N-protein concentration in phosphate buffer solution. Good linear relationship between IDS(max) and log10(N-protein) was observed from 10-14 to 10-5 g/mL with goodness of fit R2 = 0.90 and sensitivity of 1.98 µA/Log10 [concentration of N-protein] at VDS = -500 mV, VGS = -500 mV. Consequently, this prepared H-diamond SGFET biosensor may provide a new idea for diagnosis of SARS-CoV-2 due to a wide detection range from 10-14 to 10-5 g/mL and low limit of detection 10-14 g/mL.

The effects of the COVID-19 pandemic on the mental health of workers and the associated social-economic aspects: A narrative review.

BACKGROUND: The COVID-19 pandemic has struck nations worldwide, pushing worldwide health and socio-economic systems to extreme limits. Upon exposure to an exceeding number of patients and supply shortages, the resilience of healthcare resources has been broadly challenged. OBJECTIVE: We will firstly discuss the mental health turmoil during the COVID-19 pandemic as the primary focus of this study and delve into the mental health repercussions among the workforce. Also, we debate the risk factors, particularly highlighting the impact of social behaviors and media exposure. We examine the pandemic's impact on occupational health services. Secondly, we thoroughly discuss the effect of socio-economic and race disparities in the COVID-19 contraction and the related psychologic sequelae. Economic outcomes are also highlighted, particularly alterations in poverty rates and occupational sectors. METHODS: Peer-reviewed reports were extracted through Embase, PubMed, and Google Scholar until June 2022. RESULTS: A constellation of untoward spillover effects of the pandemic, including dramatic changes in public and workplace environments, enduring curfew, and low wages, have put socio-economic aspects of daily life under exuberant strain. Indeed, occupational and public health stakeholders presume a coinciding social crisis to occur, provided the pandemic's implications on socioeconomics and psychological wellbeing are not addressed well with evidence-based approaches and peer services. CONCLUSION: Evaluating the socio-economic and mental health impact is imperative to cope with the pandemic. Also, we should assess the predisposing and protecting factors in a broad array of life aspects associated with COVID-19.

Network pharmacology analysis on mechanisms of xuanfei baidu prescription in treatment of SARS, MERS and COVID-19

Objective: To explore the effective components, target and signal pathway of Xuanfei Baidu Prescription in treatment of coronavirus infection, and to explain its mechanism of action. Methods A network of Character, taste, and meridian of Xuanfei Baidu Prescription was constructed using Cytoscape. Effective components and related targets of Xuanfei Baidu Prescription were selected by using TCMSP database, SwissADME database, and Swiss Target Prediction database. Disease targets of SARS, MERS and COVID-19 were collected using GeneCards database and CTD database. Drug targets and disease targets were intersected, and Cytoscape software was used to construct the network diagram. Using String database, the network model of protein-protein interaction (PPI) was constructed for potential targets. Metascape database was used for GO and KEGG enrichment analysis of potential targets, and Cytoscape was used to construct the network diagram. Results The results showed that 10 ingredients in Xuanfeibaidu Prescription are associated with the Lung meridian. 167 active components and 242 potential targets were screened out. The core drugs were Glycyrrhiza uralensis Fisch.,Ephedrae Herba, Artemisia annua L, Verbena officinalis L., Polygonum cuspidatum Sieb. et Zucc.. The core components were quercetin, stigmasterol, kaempferol, luteolin, isorhamnetin. The core targets were AKT1, IL-6, TP53, VEGFA, TNF. The possible mechanism of action is related to several signaling pathways such as PI3K-Akt signaling pathway, HIF-1 signaling pathway, TNF signaling pathway, and so on. Conclusion This study explored the potential common mechanism of Xuanfei Baidu Prescription on SARS, MERS and COVID-19, reflecting the multi-component, multi-target and multi-pathway characteristics of TCM.